CcruzaQ_1231


Sequence

>CcruzaQ_1231 (2 EST) Length=576 TGAAGGAGGTTGTGAGGCAGATGATGCAGAACGCTGAGGGGGCAGATGCATCGGGTGTTGATAAAACTCATTTGACATCC ACATTTGGGGGAGATGAGGCACAAGATACATTTGAGCGACCTATGCACCGCAAACGGCGCAAGAATAGCTGCTATTCGGA TTTCTATCAGTTCCAGGTGAGCAAGCGTTGGACGTGCAATGCGGAGAGCTTCCTGAACAGGGGACGTGCCTACAAGTCGA TGGTTGAGGCTTCGCGGCCCCAGCGCTCTATCAAGAAGTTTTAAAAATGAAGGGATATAAACAACGGCAGGCGAATATAA CAAGCAGAACAAAAAAACAGCGGTGGTGAGAAAAGAGAGGTTTCTGTTTGTGAAATGACGGCGGCAGCTGGCACGAGTGC TGCAGGTGTTTTTTTTCTTTTCGCATTGGTTATGTGTGCATTTTTGTTTCTGTATATCCTGTCACTCATTGGGGAGAGAG GGCGATAGAGAGCGAAAGAGGACTATTTAAATGAATGCGAGGGGAAGTATTCATGAAGTGTTGTTTTATTTTTTTATTGT TATTATTGTTAAGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1231: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17973643331779AI057913TENU2005T. cruzi epimastigote normalized cDNA Library
18046983340650AI065243TENU2129T. cruzi epimastigote normalized cDNA Library


Date: 11:51:59 on Wed 22 Nov 117.