CcruzaQ_1236


Sequence

>CcruzaQ_1236 (2 EST) Length=421 CATCCTCACGAGCCAAAGGCATACCTGTCCTGGGGTTCGTACCGCTGGCATGTATTTATAGTACTGGTATGGCTGCTGTT TCCCCCACATCCACGTTGGCTGCAACCACATCTCGCGCTTATTGTGATTTGGCTGAGCAGGGCAACGCACACAAAGTGTG TCGTGGACCCACTGAAACCGACAATACTCGCACTGGAGCTTCAAATCGTTTCGAGAAAAGACAAGCTGTGGGTCCTTCGT CAATCCATCAATCTTTTTCATGTGATTTGTCGCCCTACCATCCAGATTGTTATTTGGTAGAAAAACATGTGCGTTTACTG GACCACTATACATTCCCAGAGGAAAAAAATTCATCAGAACGCCAGTGGGACACAGGTAGCGCAAGGGTCTTGTGGCCCCC CGCATTATTGCTCCTAATGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1236: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243113392549AI069574TENU2616T. cruzi epimastigote normalized cDNA Library
18244643392702AI069727TENU2771T. cruzi epimastigote normalized cDNA Library


Date: 21:54:58 on Fri 17 Nov 117.