CcruzaQ_1242


Sequence

>CcruzaQ_1242 (4 EST) Length=632 CAATATTGTCCTATATATATATTTCCTTAAAAAAGAGGCAAGGGAAATTTCCCTAGATGAAGCGATTTGCCAGTATTTCT TTTGGTGGCAGTTTCTACTTGTCGCCATTCCTTTGGTAAGGAATGGGACAATGCCTCCTTGGATACCATCTACAGTTGTA TGCTTCGGAAACCGGAAGTTAATGATCGAGTCCGGAGTCAATATGCATCTACCATGGATCCTCGTAATGCGGACGTCCTT CGTCGTCTTGGAGAGGTTGCAAAGGAGAATAAGACCTTTATTCGGGTATTTCTTTCCGCCTCAATTGGGGCGATCCTAAT CGTCTTCTTGAAGTGCTACAGCCTTATGNGCTTNATCNCAATCCTTGAATCGCTTTACCGTGGGGCCGATATACCAGATC ATGTGTTTCAGACACCCGCAGTCATTGAGCGCATTGACGAGTTTAAGGATGGCAACAAAGTCACTCAGTAGAATCCTGGA AAAACATTTATTGTTAGTATTGTAATTATTGTTTTTGCTAGGTTTGGGGGTTGGTCTGGGAGGTATTATTAGTAGAGGAG CGCAGGATTCTTTTTTGACTGTTTGCCGTTTTTGTCAGGGGGTTGTAGGAATTTGTTTTTTTTTTTCCTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1242: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860552153639AA441761TEUF0054T.cruzi epimastigote non-normalized cDNA Library
17459833216924AI007414TENU0434T.cruzi epimastigote normalized cDNA Library
17658083244426AI026600TENU0812T. cruzi epimastigote normalized cDNA Library
18387233417135AI080883TENU3741T. cruzi epimastigote normalized cDNA Library


Date: 16:10:49 on Tue 21 Nov 117.