CcruzaQ_1257


Sequence

>CcruzaQ_1257 (2 EST) Length=411 TCTCCGGGCAGTTTGGTCTTACTCCCGCTGTCTTTCAAGCCTTACGGCGCGTGTGTATTGAACTTCCATTCTTAAGCGCC GTGACATTCTTACCGTCGGGGCGCTTGTACCGGGTGTGGGAGCCCGATCCCCCGGCAATTCCCGCCTGCATGGCACAGTA AGGGCGTTCATGATGTGCTGTGGTCCCTGGTGCCGACTGTGGCCCTGTTTCGGAAAGTTCGTGAGCGCGCAAGTGGGATA GCAGTCCCACTTTCGTTTGAGCATTGAGCCCACAGGATGTGCACTGGAACGGGGTGGATGCAGTCAGATCGTCATATTCC CGGGAACGCTTTATTCGTGGCCCGGAGCAGTCGTGCATGCAGAGGTGCCGGGGATGAACTCTGCGTCGGGCTCTTTGCTC GCACGACGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_1257: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17828133290260AI043477TENU1037T. cruzi epimastigote normalized cDNA Library
17926823321018AI053391TENU1556T. cruzi epimastigote normalized cDNA Library


Date: 9:19:56 on Sun 19 Nov 117.