CcruzaQ_1262


Sequence

>CcruzaQ_1262 (2 EST) Length=410 AGTTTCTGTACTATATTGAACCGTTGTTGAGGCACGCTTGTTAACATCATGACGACGGGGTTTCTTCGCGAGGCGGTGAT CTCAGTCGCTGTATGGTCAGCGGGCGATTTCTTTGCGCAGTTCTACCACGCCCACCGCGAGGCGGCGCAAAGGCGCCTGG AAAGAAGGGAAAAGCGCAGTGGTCGAAAGACCCTCCGCAGGGCAAATGGCGGAGATGCTAGACAAGCCCCGTGTGGGTCT TTCGGCGGCATTTGGTCTAGCGATATCTCCGTTTGTTGTGCAGTATCGCAGGTTGTGTATTCGATCACTGGGCCATACAG AGAGGCGAATGCTTGCAGCATTTATGACGGCTTTCGGTCCAACAATTTTTCATGACGCCATTGACCGTTGCTTGCTTACC ACAACGCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1262: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767122275648AA532072TENF0362T.cruzi epimastigote normalized cDNA Library
18415633421606AI083183TENU3861T. cruzi epimastigote normalized cDNA Library


Date: 6:12:55 on Thu 23 Nov 117.