CcruzaQ_1266


Sequence

>CcruzaQ_1266 (2 EST) Length=365 TAAAGAGAAAAAGGAAAAGAAACAAAACTTTTGATGCACACGTGTACTCTCTCTTTCACTCTCTCTCTCTCTGGCACCAT ATGTCGTCGTTGCTGTTGTCGTCTGCCAAATGCTTGGGAAACGCAGTGTGGAGAGAGTGGAGTAACCGTGCAAGCACATG TATGCAGAAGTGTGCATGTAGACCCCACCCGGTTTTTTTGTTTGTGTGTCTGTGGGGAGTTTGCTTGATTTTGTAATAAA CACATGCACAGAAACACACACACACACAAACAAACAAAAAACAAAAACAAAAAGAAGGCCTGTGGTGACGAGTATCAACA AATCAGGGNGGAAAAAATAATAATAATCATAAAACCTCCCCAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1266: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703752267804AA525735TENF0042T.cruzi epimastigote normalized cDNA Library
17854053293911AI046278TENU1148T. cruzi epimastigote normalized cDNA Library


Date: 19:12:46 on Wed 22 Nov 117.