CcruzaQ_1269


Sequence

>CcruzaQ_1269 (2 EST) Length=732 GTCGTCTATTATGGCGGTGTTCATTTCCTTTATTGACATCAATGTTGAGTGAAGCACGTGCGTCCAGCTGTAGTTTGTGT TTCGTGCTCTTCGCCTGTGATGTTGAAGTGGCGTCGTTGATGGCGAGAGGCGCATGGCCATCAGTTGCAATAAATTGACT CGCATAATGTGACAAATCAAGAAGAAATAAAAAAGATTATACAACGGTCGTGCCATGTTTCTTTTTTTTTTTTCCTCTCT TTCTTTCTTTCTCTCTGCGCCGGCAACCAAAATAATTATTTCCCCGCCTTTTGCCGCTCCCCTCAACGTTGCAGCGCCAC CATTTCCTCTCCGTCTTTCCATCACGCACCAGATGCAAATCGAGAGGGACACACACACGCACGCAAACACAAACACACAG AGAGAGACGATAATCATGCGACCAATGATTTATTCATCGTAAGAAAGGGCCGTTTCTTTACGTTCGTGTAAAGAACAAAC ATACTCAGAAACATATTGGCTCCCGCTTCCCCAAGTTTCCCATGCACAAAAAGTCGCAAAGCCGCTCATCAATCAGTAGA AATATCATACACAAATAATAATAATATTAATAATAAAGTACTCAGCAAACACAAAAAAAAGTTTGGAGTTTGGAGGTGGC GTTTCTTTCTCTCTCTCTCTCTCTCTCTCTCTTTTTTTTTTTTCCGTTCGTCTGTTTCTTTCCTTTCCTTTCCTTTCTTT TCTCCCCAAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1269: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18056513366308AI066143TENU2534T. cruzi epimastigote normalized cDNA Library
18687373482744AI110324TENU3294T. cruzi epimastigote normalized cDNA Library


Date: 21:9:43 on Sun 19 Nov 117.