CcruzaQ_1292


Sequence

>CcruzaQ_1292 (2 EST) Length=638 GTTTCCATTTTTGGTACGGACTATCCCACCCTTGATGGGACGTGTGTGCGTGACTACATTCACGTGTATGACTTGTCCAC AGCTCACATTTTGGCACTGGATTACTTGGCGGGGCTAGACCCGAACGAGAAGGCCACGTTTTTTTCGGCATTTAATCTCG GGACCTCACGTGGATACTCCGTACGAGAGGTCATTGAGGCTGCTCGCCGCGTCACGGGCCATCCGATACCCGTGAAGGAA TCTGCACGTCGCGAGGGCGATCCACCGGTACTAGTGGCATCTGGTGAGGAGGCAAAGAAGGCGCTTGGATGGGAGTTGAA GTACGACAACATTGACAAAATCATTGCCTCTGCATGGAAATTTCACCAGTCACATCCATTGGGCTATTCCTCTTAGGATC GCCATCAAAAAAAAACAACAAAAAAAGCGACAACAATACTGAAATAAAACGTTTTTTGATTGTGTGCACTTCTTTGAGCG TGGTTCTTGGGGTTACAGCATTTTTTCTGGGGTTTGGGGGTAATTTTATAATGGTCGAGTCTTTTTGTTTTTTTGTTTGC TCGCTGATAATGTACATGGAGAAGGGAGGGGACACACGCACCTGTTGAATGTGCCGTACCGCTTTTATCAGTCTGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1292: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459583216899AI007389TENU0409T.cruzi epimastigote normalized cDNA Library
17459643216905AI007395TENU0415T.cruzi epimastigote normalized cDNA Library


Date: 12:5:23 on Thu 23 Nov 117.