CcruzaQ_1316


Sequence

>CcruzaQ_1316 (2 EST) Length=683 GGCCGCATCGGATTGTGGTGCGGTTCCTGCGCCAAGGCCGGCTGCCCGCAAAGCATGCGCTTCCATCGCTTCTTTGATAG CCTGTTCAATTCGCTTCTTCTCGCCACACAAACGGACCAATTCAGCGTCGAGTTCTGCGGCACTTTGTTGAAGCGGGGCC GCTGCATCATCTTCCCCCCAAGAGCGCTGCACCTCGTCCAGGTCACATGTATGTCACGCCACGTAGTCACGAGGATACTC GCCTTCTCCAGCTTGGCTCGCGCGTGCTCGATAAGAAGCGCCTCCTCCNCCTCGCTCTGACGGACTGTGTCCATGCCGGC CATTAACCTGAGCTGTAGTGCCGCTGCTCCTCAAGGAGGTGGTCCAGCTCTTTCTTCAAGCTCCACTGCCCCGAACCTCA TTCTGTGCTGTCTGTTGTTCCAGCTGCTGCTGTTCCTCAAGTGGAAAAGGCCAGTCGCGTCTCGGCTTCTTTGCGCTTCA TCATAACAACACGACGGCGTGTCTCCACACCATTGAGGTGGTCCATCAAAGAAGACACCGACGACTCCATCAAATTGAGA ATAAAAANACACACAAAAATCCAAACTTTTTTCCCTTCTCACACGTTTTTTTTTTTATACTATTTTGATGTAGTTTTGTC TGCCTTACAGGTGAAGTAAACGCCCTTTGAAAGCCGGACACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1316: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767362275672AA532096TENF0418T.cruzi epimastigote normalized cDNA Library
11767652275701AA532169TENF0271T.cruzi epimastigote normalized cDNA Library


Date: 4:22:40 on Fri 24 Nov 117.