CcruzaQ_1342


Sequence

>CcruzaQ_1342 (2 EST) Length=478 GGCGCTTCCTCGCCTGGCAGTGACGCAGCGGTNGAGACAGGAGACCGAAGTACGGTGCAGGGAGATGGANCATCAGAAAC TCTTGTGGGTACTCCCGCCACAGCAGATGCATATGCCCCTAACGCTGAAGCCATGGGGCACGATGGAACCGCAGTGAATC CTGGGGCGAGCGCGAGCTCAGGTGCGGATGGGAAGAAAGGCGCGAAGGAACGAATGGGCAGGAAAAGGAGGAGATCCATG CACAGAACGGGGACGTAAAGGCTGCGGCCCTCAGCAGCAGTCTCGGGAATTTGTCGCAGGGGAATAACACCGATGCCTGC AGTGTGTGCGGGAGCGGACTGCTGCCACTTCTACTTCTTCTGCTGTTGGGACTGTGGGGGTTTGCGGCTCTGTGAGGAGT GACTGGCTGCCGCGTGGGAAAATCGCGCCCTCCCTGCACGGAATTACTTCCAANAAATGATATTTTCTTTAANATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1342: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16095942991743AA882632TENS0203T. cruzi epimastigote normalized cDNA Library
16100872992648AA883049TENU0307T.cruzi epimastigote normalized cDNA Library


Date: 9:41:37 on Thu 23 Nov 117.