CcruzaQ_1346


Sequence

>CcruzaQ_1346 (2 EST) Length=552 CAAGCAGCGGAACACACTCTTTCTTTGCCCGCAGACAACACTGCGTAGTGGAGAACTGCTCAAGAACAAAAGAAAAAAAA ATATATATATAAACCATATATGCCCCTGCAAAGAAAAAAGAAATGGGAGGAAAAGAGAAAAGGGGCAACGAGAGAAGGGC GACAAAGCCCATCTTTCCCACCAAGAGGAAAAAAAAAAAAAGACAAACACCATGGGCGGAGACACACATGCAGAAAGCAT CATTGGACGGAATCCATGGAATCCATTTACCACCTCTTTTTTCTCTCGTCCTTCTCGTCTCTCTCGGCCATTGGGGGGGG GATCACTGTACATATTATTTGTTTCCTTCTTTTTAGTTGATCAGTAGGGGCGTTCAAGGCTGTAGCCAAAAAGCTCCGCG TGGTCGGCGTCGTCAGGTCTCCTGTAAGCCGTGGCCGACTGATTCATACGCGCCGCCGAATTTAACAGGCGCGAGGCAGC AAAATGGCCCTCACTTTTCATCGCCAATGGCACTGACCATCCGATGTCCTGTGCGGATGTCTGCGGCTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1346: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17658033244421AI026595TENU0807T. cruzi epimastigote normalized cDNA Library
18246063392844AI069869TENU2917T. cruzi epimastigote normalized cDNA Library


Date: 19:14:2 on Thu 23 Nov 117.