CcruzaQ_137


Sequence

>CcruzaQ_137 (2 EST) Length=552 ACTTCTGAAGACAAAGAAATTGTGTTTTTGGTTTTGTTTTGTTTTGTCTTGTTTTTCCTTCTCCCTCGTGTCCCGTCCAT CCAACCCCTGCAACGAATAATGCCGCTCTCCTCCCACACGCGGAGAAAAAGAGAGAGTGTGTGTGTGTGTGTGTTGGGGA GGCACAAACGAGAGGGGCACGCCGTCGTTGACAAGAAACACGGGCGAATTTGCATATCATTCATGCACCCTTTTTGTTTG CTTGATGGGTTGACTGGTTGGTTGGTTGGTCAGCGGCTGTTGAACACACATTCGCTCTCAGGCGAAGAGTCATTGGGGGG TGGAGCCGGGCCTCAGTCAGGCGCTGGCACCACAAACCTGTGAAAAGGATGTGCATGTGAGATCCTGCGCAACCCCCCTC TTTGTCTGTGGGTTGTTCTCTCCTCTCTCCCGTCCCCAGTCCGCCGGGGAGGACGGGGTGTGGGGGTTTCCAACACCTCT TCCTTCCTTCGTGCATGAGCAGGAATTAGGGCGTGTCTGGAGGGCGTCGCGTCGTGCGTTCCCTGTTTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CcruzaQ_137: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243333392571AI069596TENU2657T. cruzi epimastigote normalized cDNA Library
18245963392834AI069859TENU2836T. cruzi epimastigote normalized cDNA Library


Date: 0:2:42 on Sun 19 Nov 117.