CcruzaQ_1371


Sequence

>CcruzaQ_1371 (2 EST) Length=649 TTGCACCCAAAGGCCGTGAGTGGGATCGCCAACATGCTCTCCGCCATGGCATTGGCCCGACAGCGCAGGAGGCCATCATT TACAGACGCATCGATTCGAGATATCGCCTTCCGGGTGACTATGTGCGTCGAAATGGACGAGGGGAGCTTGTGGATGTACG TGGACGCCCGATGCGCGCAGCTGGAGCGATTGCACGTAAAAACAGTGAAGCCGCTTTGTTTAGCGGAATATGAGCTTTCG GATTATTGTGGAGTTTCTGTTTCCTTGCAGAGACGTTGGAAACTATGACTGGTGATAAGGAGCCTTCCGTTGGTGGAGAT TTGCTCTTGTATTTCATTTGCATGAATTTTCGAAGTGGGTTTGAAAAAAAAAAAAAAATAAAAAAAAAAAAAAAACAGTT CACACCCTTTGAAACACCACAAAAAACATGTAAATTAAAAAATAACAGGCATGTAGACTTTGTTTGTTTGTTTGTTTGTT TGTTGTCTTTCTTCCTGTTGTTGTATCCACTCAGTTGACATACGTGTGGTTGTCACCAGTTTGTCCACTCCGGATCTCGC TCTAGCTGCTCCATGTAATGCAGTACGCGTTCCGTGATCTCTGATTCATCGTAACGGTTCCCAAAAAAGTCCACAAATCG CCCCTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1371: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768442275780AA532148TENF0243T.cruzi epimastigote normalized cDNA Library
17459133216854AI007344TENU0364T.cruzi epimastigote normalized cDNA Library


Date: 21:31:36 on Fri 24 Nov 117.