CcruzaQ_14


Sequence

>CcruzaQ_14 (2 EST) Length=612 ACCAGCGTGAAATGTGTGACGAGACACTTCCGCATCTACTCCGCTGCCCGGCTCTGTAGGCGCACAGACAAAAAAAAGGA GTGGACGCTGGGGAATTGATGAATCTGTGCTTTACAAAAAACTTCGGCACAAGGCTTTTTCTCTAGGGGGAAAGGCTCTG CCGCCCCCCAAGCAGCACTCCCACGCGGCGAGAAGGCACAAAGCCCCTCGCAAATGCGGCAAATTGCCTTTGCTCCTGGT AGGCTCCCCTCTTTTTCTCGTCATTTACAGACTTCTTTTTCTAATTTATTTGTTTCTTGATTTCTTGGCAGTGACGGATT ATTTATTTACTACACTACCCCGAGGGGACGCGTAACGGGTTGTGTTTTACGCCGTGTCCTGCAGCGCCATCTCCAGGGGT TGGGGTTCTCTTCCGCATCTCCAATCAGCATGGCGGACGTGCTTTACGATGGTGGCCGGCGTGAGGGTCTTTGAGGTTAT TTAGGAAAAAACAAAGAAAAGCAAGAAGTGAATAATAATGAATATACAAATGCCAAAATTGGCAAAAATATATAAATACC GATACCCATTTGTTTATCCAGGGATGTATATGTTTGTACTTAATAAAGCAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_14: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099282992077AA882966TENS0543T. cruzi epimastigote normalized cDNA Library
18337023415216AI078944TENU3662T. cruzi epimastigote normalized cDNA Library


Date: 9:56:15 on Wed 22 Nov 117.