CcruzaQ_1410


Sequence

>CcruzaQ_1410 (2 EST) Length=435 CCGATTTAACTCCATCTCCAAGTTGGACCCGTTGGAGGATCTTCCGCGGGAGTCGCTGCGGTACCTCTCACTTTCGTCTA ACCCGTGCTGCCGCGGCGAATCCGCGTTAGCCGCAGAACGGGATGCGTACAGGCAGAGTATTCTGCAATGCTGCCCGCTT CTTGAGATGCTTGACGATCTGCCGTGCCAAATTTCATCTTCCAGTGACGGGGATGACAGTGTGGTGGAGGGAAAAGAAGA AGAAGAGGTGCCTGATGAAGGGAGAACGTCGTCGCTTCCAACATCTCATTGATGACGCACCGGAGCANTTGTAGCCATTT TTCGCACACGAATTAGCCATCTTATGAGGGATTCACAGAACCGCCATCCNATTGAACGCATTCGGTTGGCCCGTCTGCCC GCCGTNAAGAAATTCGTCAGGGTTCAACGGCGGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1410: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767422275678AA532102TENF0431T.cruzi epimastigote normalized cDNA Library
13815482655626AA675962TENF0429T.cruzi epimastigote normalized cDNA Library


Date: 18:45:20 on Sat 18 Nov 117.