CcruzaQ_1411


Sequence

>CcruzaQ_1411 (2 EST) Length=395 GGTTGTGAGGAATGAGAGCCCGGGGACGCGAGCATCCGCCCCCCCCACCACCACCCGACTCTGCCGCTCGGTTCACATCA ACACCCCTCCATTCACTGGCCGCTGTGTTTTTTTTCCTTTTTTTTTTGTGTGTGCTTTGATTTGTCTTTGACTTATATTC TTTTCACGGCTGAGACTTTTTTATTTTTTTTTGGTTGCTTCCCTTCTGTGCGGCTTGTGGCGCGCCTCGTTGGTGCCCGG CTGCCGCAGGGGGAACGAGGCGGGAAAGGGACTTTATTAATTTTTTTTTTGTAGAAAACCGGCGGAAAGAAAAGTAAAAA AAAAGGGGAAAAAAAAGAGAAGAAAAAGAGGGAACGCGGGAGTGGGGGAGCGAGTGGATGCGTCTGCTGCTCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1411: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13816002655678AA676014TENF0528T.cruzi epimastigote normalized cDNA Library
17973593331774AI057908TENU2000T. cruzi epimastigote normalized cDNA Library


Date: 16:21:45 on Fri 17 Nov 117.