CcruzaQ_1414


Sequence

>CcruzaQ_1414 (2 EST) Length=399 TGGGCTGCCCAGCACCTTCGCGAAGTACGAGATCTCCTTCTCCATCAAGTAGCCGGCGGCACCGTGGCCAAGCACCTTTG GAATGCCCGTCATCGTCGCACTCTCGCGGTGGGCTGTGCCAAAGGCGTCACTGATGTACACGTCGCCGTACGACGCCAGT ACGCGTGCCATTGCGTCACGCTCCTCCTCCTTCTTACTTCCCTCCTCCACGTAGAAGCGCACGTTCTCGAGCAGCACAAC CTCGCCTCTCAGGAGACAGCTTTTCGACCGTAGATGCCGCCTTCAGGCAGTCCGGCGCAAACACCACAGGAACATTGAGG AGCTCGCCGAGGCGTTCTGCCACAGGCTTCAACGTCGCTCCAGCTTCGTACCCGGGCACACTGTCGTCGCCGCAAGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1414: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18387213417133AI080881TENU3739T. cruzi epimastigote normalized cDNA Library
18689863492623AI110416TENU4019T. cruzi epimastigote normalized cDNA Library


Date: 7:41:49 on Sat 18 Nov 117.