CcruzaQ_1418


Sequence

>CcruzaQ_1418 (2 EST) Length=610 GGCAACAGCAAAGTTTGGGGTAGAAGGCAATGAACGTCGACGGCGCTGGTGTCATTGGCCTCAATGTCGCCTGCAAGTGG GTATCTGCACCCAGCACCCCATGCGTCCTCATGGAGGAAAACACGCGAATGCATAGACAGAAAACGCATATTTGTTGAAG GGACAAACAACACCCTAACCTCAAAGACAGCCAGATCGGGCCACAGAGAAGACACAAACAGACACATGCACACTCAGGGA TGGATCGTCAAGTTACATACGCAGCATTCTCAACAGTTGGAGGCCATAACGCACCGCGTGGTACGACGTCCACCAGTACG AGCCCGAGACATCCACCCACGTGACGTCGAGCTCCATGTTTCCCTCATCCTCATCCTCCCCCAACATCGTCACCACCGAC GCGTAGGTGGAAACAAAATCCAGTTCGTCTTGGAGTGTCCAGCCACACGGGGGGCGTTCGCATAAAGCCCACCGCATCAG CGCAAGACGCAGCATCCAGACAGCCTCGTGTCCCTTGTCGTAATGTCGGCGTAACTCTTGCGTGGTAACAGCTAGTAGCC TCCCCCACACGTGCAATGCCACGGAGTCGTGCTTATCAAAATAGGCTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1418: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17854553293961AI046063TENU1099T. cruzi epimastigote normalized cDNA Library
18047663340718AI065311TENU2198T. cruzi epimastigote normalized cDNA Library


Date: 17:49:51 on Fri 17 Nov 117.