CcruzaQ_1431


Sequence

>CcruzaQ_1431 (4 EST) Length=453 CGTTACTGGAAAATTTTGAGAAGAAAATTGAATATAGAGTNTCGGGTGCTGTACAAACCGGTGGCTCAAAACTTTCCGCT GGTGGACGCCTTTTTCTTTNTGGAGTCAAAACCGAAGACNATGGTTGGGCTGCAGATTACTACGGCAAGTGAGCACCACA CCATACCCAGCACCGTGAATCTGTTCAAAGAAAATCATGAGCGAAATATTTTAATGGTTGGGATGAATTTTCCCGAGACA TGTCGTGGGAGATTATTTATATACAACACGCAGACAGCACGCCGATGGACTGGCTGGCAGAGATGTGGTCNCGCCAAAAC CGATAATTTGAGCGACGATGAAAANGANATTGTGGCGTTCTGGGAGAAGGAGGTACACCAGTACCAAGTTTCTGTATCTC AGAACTTAAGAAAGAGCTCTCCTTGTGGAGAGACAACAGAACNATAGAATGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1431: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860302153614AA441736TEUF0279T.cruzi epimastigote non-normalized cDNA Library
11767882275724AA532192TENF0315T.cruzi epimastigote normalized cDNA Library
12064042327483AA556031TENF0039T.cruzi epimastigote normalized cDNA Library
18047783340730AI065323TENU2210T. cruzi epimastigote normalized cDNA Library


Date: 0:19:43 on Thu 23 Nov 117.