CcruzaQ_1443


Sequence

>CcruzaQ_1443 (2 EST) Length=603 TGTGAAACCGCTTTTATTTTCGTGATCCCTATTTGGAATGCGGGCATTACATTGCCGCATGCAATTTTTTTCCGACAGTG GGCTGAGGGATTCGAAAGCATCAGTCACCGCTTCCCATTGCAACCAGGCAGACAAAGGAGACTGTTCCGGTCAAAAGTTT AAGCCACGTTATACTCATGAGTGAAGTGTGGGAATCGGTCAGGCCGCGGAAGAACAAGACGGGTGTGTGGGCTGATCTTA CTTAAGGGTGTCTGGCCGCATGGAAAGAGGGAGCAGTTCTGACCGAGCAGGCCTTATCTTGGTTTGTTCCAGGGCCGCGG TAGTGGAATTCTGCTTGTGCCTTCTCTGAGCGGTCTGTTGGTGGAGTCACCGTTATGTAAGGGGGGTTGCTCAGGCGCTG ACCAGGGTGAATGTGGAGCACTGCACGGAAACGGCGCTCCGCNTGGTTGAAATTTGACATTGTGTTTTGTTTTTGGCGTG AGGTGTTGTGAGATGCGCGTGCTTCGATGCATCCACTGCAGGCACTCATGAATCCACACATCTGCAGCTCCGTGGGGATG CAACAGCAGCGGCTGCGTTGGACGGACTGTGCACGGCTTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CcruzaQ_1443: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16026652982424AA875824TENU0218T.cruzi epimastigote normalized cDNA Library
17972853331700AI057834TENU1925T. cruzi epimastigote normalized cDNA Library


Date: 8:35:29 on Fri 24 Nov 117.