CcruzaQ_1451


Sequence

>CcruzaQ_1451 (2 EST) Length=408 GAGGGTGTTTTTTTTCCGTAGCGAACTCTGCACGTGAAAATAAGGACTTGTAATATCCGAGTATGTTATTTGTTGGTGTT TTATTTTTCTTTTGTCTCCGACACAATTTGCAGAAAAAAAAATATAAATAAACGCTCACGAAATCGACAAGAAAAAAATA GACCCTCATTTGGCTGCCGTCTTTTTTTTCTTTTTTTTGGTTTTAAAAGAATTTCTTTCGTTAAAAAACTGTGGGTTTTC CCTCGTCTGCGTTCCCGCACTCACGGAGAAACAAAAGGAGGAGGAAAAACTTATGAATTCATGTCCTTCCAATTGAAATG CCAGTCCGCCCTCCCGTGGAATACGTAAGTGCTCGGCCTTGCAATCCGCAGCGTTCAAAACATCTCATATTTATTGATTT GCAGCGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CcruzaQ_1451: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16061752988299AA879334TENU0234T.cruzi epimastigote normalized cDNA Library
18243513392589AI069614TENU2675T. cruzi epimastigote normalized cDNA Library


Date: 0:48:49 on Fri 24 Nov 117.