CcruzaQ_1464


Sequence

>CcruzaQ_1464 (2 EST) Length=440 AAGGGCCNAAAATTCCCGCGCTTAATTCCCNAAATTCTTTTAACAACCGCNTGACCCCGGGGGACATNCATGTTGGATGA AACAGNAANCATTAATGGGCCTAAGGCATATCTCATTCGAAGATTCTGAATGGGCCACTGCTAAGGAATGCATTTATTTA TCTCTCGCCCGTTCCAGGCAAATCTGCTCGATCCCGAAGCTGAAGGAGCTGCAAGACTCGATAACAAAGTGCATCTGGGC CGCAGTAACAATACGAATCAATTGTCTCCAATCAATCCAAGGAATATGCCCAGCAAATTTTTGCATTGCGGTAACTTCGA CGCCTTCATCATCGCTCTTGTATGGACTACCACGAATCACGTGAGCCATCTTTAGAGACACTTTTAGCGGTAACTTGTCA CGCAGACGGAAAAAAAAACCTCGTGCCGAATTCTTGCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1464: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860732153657AA441779TEUF0095T.cruzi epimastigote non-normalized cDNA Library
16095312991680AA882569TENS0140T. cruzi epimastigote normalized cDNA Library


Date: 21:52:18 on Mon 20 Nov 117.