CcruzaQ_1474


Sequence

>CcruzaQ_1474 (2 EST) Length=388 ACGAGGAGAAGNGGCNCTCTCTTTAGGGTGTGTTTGGAAANACAGCTCCTGCGTCTGATGTCTCCCTCGTTTCATTGGAN ATGTCACTGTTTACACATGTCCTTCGGTACCTTCGAAATACATGTGGCGTGTCAAATTTACAACACCTCANAAGCCTTCA TCAATGTATGGAGTTTGAAAAATTTTATCAGCTCGTACATCCACTGTTTAGTGTCTCTACTCCAACGTTGGANAATGCGG CTATTTTGATTATTTTGGAGTCTGCCGCACTCTGGGCGGTCTGTCTTGTTTTTCATCTTCGCTGCTCCTATCTTTTTACG CATTTGATTGCCGTGACGGGGTGTGCTGGCTCCGGCTGCAAAACGATGTGCAATGCCATCACACGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1474: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188173017665AA890786TENS0633T. cruzi epimastigote normalized cDNA Library
16188183017666AA890787TENS0634T. cruzi epimastigote normalized cDNA Library


Date: 6:3:4 on Sun 19 Nov 117.