CcruzaQ_1481


Sequence

>CcruzaQ_1481 (2 EST) Length=421 TGGGGCCAGGGGGTGAGAAAAGAGGGAAGCCGTCAGCGTCAAACAATATATGTATATGCGCCTCCCCTCTCCCTCTGTAT TGGGTGAGGCATTGCACTCCGCTTCCCACTATGCAAATGCACAACGGGGAAAGGATGACATGTCCCGCCGCCACCAAAAT CTCCCCACGTGGAGGGCCATAAATGATAATAGTAAAAGCAGAAGTAAGAGGAGCGAGTGGGTGACAATGGAAGGGAAGAA AGAAAGAATTGCACCCTCGCTGCCATCCACAGCTCGGCATCCTCGGAGATAAAGTGACAAAAAGAGATCAGGCAACCAAC AGTAAAGAAAACACGAGAAGTAAAACAACACGCGTCACTGTCTTTCTTAACCTCATACACAGGAGTCGCACGCACACACG TACACACACATTCCCTAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1481: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775862130769AA433292TEUF0106T.cruzi epimastigote non-normalized cDNA Library
18386793417091AI080839TENU3548T. cruzi epimastigote normalized cDNA Library


Date: 11:44:25 on Fri 24 Nov 117.