CcruzaQ_1484


Sequence

>CcruzaQ_1484 (3 EST) Length=503 AAAAGAAAAAAAAAAGATATATATATATATATATGGTAATGCCAACCTATATTTATTTATTTTCCCTTTCCTTTGTTTAT TTTGGGAAGAATGACACCAACCGTCTTCGGCCGTTTCTCAATTGTTTTTGCTCTCAGCTTTTCTTATTGTTCTTAATTAA TTCTGTTTTTCTCTCTTTCTGCACTCGTTGCCTCCCTCCATCGTTTCTTAGGCTTCGTCGCGGCCTTCCTCCCGTCGGTC GTAACATTTGTTGAATTCTGTCTTATGCTCAACGTCTTGCCAAACTCTGGGCCACCGAAACCAAATGCGGGGATCTCTAT AAAGCACCACGATAAATTGCAGGGCAATTATCCGGAAGAGCACAGTTAGGAAGAAAGAAAAAGAACAGGGAAGGATGGAG AAAAAGAACAAAAGCTCCTTGCCCACCTCCCCGTCCACCAACATTTTTTCTGCATATCATGTACTCGGTTCCGTCTCTAT TTTTCTTTTTTTGTTGTTGTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1484: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776082130791AA433314TEUF0145T.cruzi epimastigote non-normalized cDNA Library
17610503237457AI021844TENU0531T. cruzi epimastigote normalized cDNA Library
18318683411402AI077094TENU3241T. cruzi epimastigote normalized cDNA Library


Date: 10:56:18 on Tue 21 Nov 117.