CcruzaQ_1529


Sequence

>CcruzaQ_1529 (2 EST) Length=453 GTTCGTTTGTTTTGTTTTTTTGAGAAAAAAAAAAAAACGTGGAGATATTTATTCATTCGCCCCTTGGCTCTTCTCTACTG GTGGAGGGTAAAAGGAAAGGATTTTAAAGGCTCCGTTGCAATCGCCGCGGTGGCGAAGGACGTTGAAACAGCGAAGNAGG ACGAGGTGTAGCGATGGTGATCGTGGTGTACATTGGCTGACCCTTCATTCCCTTCCGGTCGAGCAGGTCCCCTCCCCATC GCTGCCACAATCGCTCCTGCCGTAGAAATTATCAGAAGAGGAGGAGGAGGAGGAGGAGGGAAAAAAGGAAGAACCGCTAC TGCTGCTGCTGCTTGAATTCTCCTCTTCTTCCTCCTCCTCAATCATCCGACGATGACGCCCCTGTTTTAATCCACCGCTG CTGCTGCTGCTGCAGTTGTTGTTGGTATTGCCGCTGTCCCGTTTGTTTGTCGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1529: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11703772267806AA525737TENF0047T.cruzi epimastigote normalized cDNA Library
18056863366343AI066178TENU2569T. cruzi epimastigote normalized cDNA Library


Date: 14:28:32 on Tue 21 Nov 117.