CcruzaQ_1539


Sequence

>CcruzaQ_1539 (2 EST) Length=381 GGCACGAGGTTGAAACGACCACTCCGTCAAGAGAGAAAACTCGAATCACCCACGTGGATAAACCACACAAAAAAACACAA AAAAATACCAACACTATTAAAAACACGAACTACTCAAACACATACACACACGGAAAGCAACATAATCCGTCCCAAACCAA ACGAGCCTGCGAAGACAAGCTCAGCAAATACTTCCGCGAGGCGTTCCTTCTTGCGTCTGACCGCCCGCCAGTCCACACCT CGCGCCGCGGTGTTACCCGTCTCGTAGCCGACGACCTCAAAAGACTACACGATTCCTGTTCCGCCGTCGACCGTCGGGCG GCCAGAAGGACGCCGGGGCAGTCCTCGGCCGCAAGCTTATTCCCTTTAGTGAGGGTTTAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1539: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064132327492AA556040TENF0155T.cruzi epimastigote normalized cDNA Library
15926762961946AA866501TENU0073T.cruzi epimastigote normalized cDNA Library


Date: 10:35:0 on Sat 18 Nov 117.