CcruzaQ_1564


Sequence

>CcruzaQ_1564 (2 EST) Length=378 AGTTCTTTTTTTATTTTGTTTTTTTGTTTGTTTGTTTTGCTTTTTTCCGTTTTTCTTCCGTTTGCCCCATCCCCTTCAGT CCCTTCTTTGAAGGATCCCTTCGGGCTGCGTGGCTACTTTGTTCGTTCGCAATGCTTCCGAAGCGTTGTCCCGATGAGTT CCTTCACTTTGGCCTGGTCCAGCTGAACGCCCTTCGCCTCCAGCTTCTTCCAGCGTACTCACAAGGTGCGTGACGTTGCC CGCCTCAGAAATTGCGTCTAAAAGACGAAGAAGACCCACCACCTCTGTCTCCACGTTGCCGCCGCGTGGCACATCCGAGT CCGTAGGGATCCCATGAGGGCTGACGCCATGAATGACTTTTCGAAGTGTATCGTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1564: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17656533244271AI026445TENU0656T. cruzi epimastigote normalized cDNA Library
17927483321084AI053205TENU1630T. cruzi epimastigote normalized cDNA Library


Date: 17:12:1 on Fri 24 Nov 117.