CcruzaQ_1586


Sequence

>CcruzaQ_1586 (2 EST) Length=387 AAATAAGTAATAATAATAATTTTAAAAAGTGCTTATGGTTCAATCCAAGACAACCGGACTCGTGGTGAGCTCACGAAGTA ATGGCCTTTTTGAAGGACCCCCAGCAACCACCGGACTCCTCTCCGCGTGAAGGGCAACAGCGGAGTGAATGGGATGACAG GAACAACAAAACCAGGAAAAAAAAAAAACAGTTTGCAGTCTTGCCAGATTCCAGGAAGGCATTTTTGGAGGTATAAATCA ACGGTTCGACAAAAACAACAACAAAAATAAAACTCAATTGGGAATCCATCAACATGCTCTATCAATTATTTGACCACTGC TGTTCACACATCCATTCCACAAGATTCTAGCAAATAAATGCACCGAGCAATCCACTCGTGCCGANTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1586: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190093017857AA890978TENS0828T. cruzi epimastigote normalized cDNA Library
18415453421588AI083165TENU3843T. cruzi epimastigote normalized cDNA Library


Date: 19:8:3 on Thu 23 Nov 117.