CcruzaQ_1592


Sequence

>CcruzaQ_1592 (2 EST) Length=458 TCGCACGACTGAGGGTCGCCTTGCCGAAGCGCGCACGCTGAAGGCCTTTGCCAAGAAGGCTGACATCATCCGTGTTGTTG CCCATACCCAACTGCGCAACTGCGTAACAACCGTGTTGGTGTGAAGAAGGCGCACGTGAGCGAGATCCAGATCAACGGCG GCACCATTGCCGAGAAGATTGAGCACGAGGCCAAGCTCTCTCCTGAAAAAAGGAGGTCCGCATTGACTCCATCTTCCAGC AGTCCGAGACGTGCGACGTGTGTGCCGTGACAAAGGGTCATGGGTTCACTGGTGTCGTGAAGCGCTGGGGCGTTGCCTGT CTGCCGCGCAAAACCCACCGTGGTCTCCGTAAAGTGGCCTGCATTGGCGCGTGGCACCCCGCCCGCGTGATGTACACCGT TGCCCGTGCTGGCCAGCACGGCTACCACCACCGCACGCACCTCAACAAGAAAATCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1592: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15941392963395AA867950TENS0058T. cruzi epimastigote normalized cDNA Library
18416263421669AI083246TENU3839T. cruzi epimastigote normalized cDNA Library


Date: 2:21:17 on Mon 20 Nov 117.