CcruzaQ_1597


Sequence

>CcruzaQ_1597 (2 EST) Length=388 AAGTGGGTGCCCGAAACGAGGCTGCCTGCATGAATTACGAGGCATTCCAACCAACGGACCTTAACGGCATGCTGGCAATG CCACATACAATCAATTTGCTGACAATCGCGCCAATTGACTGCTTTCTTGTATGCCTTGCCAGCGTGGCATGGGGGATCTT CTACTGGGATTTGTACTGCCGCCGCACCTACAAGACGGTCCTCATTGCCCGGCCGGAATCTTTGCGCTGATGGAAGAATG AATGCATGAATGAATGGATGGGCGAGGCAGAGATGGAACAAAGAAGGAAAAAAAAAAAAAGAGGGTTTGAAGTTTTTTGA ATAAGCACAACAACAACAACAAAATAAAATGGTTTTACTTGAAATTTCCGTTGTTGTCTTCCCCAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1597: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11768492275785AA532153TENF0056T.cruzi epimastigote normalized cDNA Library
17971583331573AI057707TENU1797T. cruzi epimastigote normalized cDNA Library


Date: 20:35:15 on Tue 21 Nov 117.