CcruzaQ_1602


Sequence

>CcruzaQ_1602 (2 EST) Length=388 GAAACACGTGCTGCAGTTGCGTCAGAAGTCAGCGCAATTCGCACAATACATGAGTGGAGAAAAGAATGCAGCATGCAGAA AGCAGTGGGAGAGGAAAGTTAGTCAAATTGAACAAGAACTGGAGGCAGGACGTCATTTCCGCAACTATGTGCACGTGGAC ATGGACATGTTCTATGCCGCAGTGGAGATGAAGAAGAATCCCTCACTTGTGGACGTCCCGTTGGGCGTGGGGACCTTTGA TATGCTCTCCACAACCAACTATGTGGCACGGCGCTACGGCGTGCGCTCCGGGATGCCCGGGTACATTGGCGTGAAACTCT GCCCGTCACTCGTTATTGTGCCAACAGACTTTGATGCCTACCATGCAGAGGCCGCCGTGGTACGTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1602: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459973216938AI007428TENU0448T.cruzi epimastigote normalized cDNA Library
17826773286599AI043342TENU0983T. cruzi epimastigote normalized cDNA Library


Date: 1:53:35 on Sat 18 Nov 117.