CcruzaQ_1605


Sequence

>CcruzaQ_1605 (5 EST) Length=749 TGTGATGGGCAATCGACTGCAACCGTTTGTAAACCGACTGCCGCAAAATCACCCGGGCGACCCCATCGCCGCTCGCATCC AGCAAGGACCCTCCGCCGCCTCTGACGGCATGCACACCGTTTCAGACGGCGGCTAGTCACCGTGAGCCAAGTGCGCATAA TATGAAACAGTGACTGTGCGCGTGCCAGTGGTGGTGGGTGGAAGTGATGGATGTAAAATATATATATATATATATTTATA CTGTACGCCTTTTTACACGACCACAAATGGTGGGCAAACAAACAAACAAAAAACTCAATCATTTGAAGCGGACTCCATCC CTTCATGGACCTCTTTTCCTTTTTGGCTATATATAATATTATATATATATATATATGTGTATATGTACAGCTATGTATTT GTTGGAGGTGTAAATGGGAGAGAAGTAAACGGGAAAAATAAATACGCACGGAAGTGAAAAGTCTGTCTTTACGGTTTAAG TTCGTGCACGAGTGTGTGTATTCAATGAAGGCGTGAATAATACACGCAACCCACAACGGCAACGAGAAGAATAAAAGCAA ACAAAAAGACAACGAGGAAAAGAGAGCAAGAAAGAAAGAAAAAAAATGAAAAAAAAAAAAAAAGATANTTAACAAGAAGG AAAGAAAAGGGCANTAAAGGGGGGGGGCAAACNCCCCCCAAAAGAAAAAAAGAAAGAAGGGAGGAAANTNTTATTTATCA CGTATTATTATTATTTTTTTTTTTCTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1605: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860572153641AA441763TEUF0056T.cruzi epimastigote non-normalized cDNA Library
16096142991763AA882652TENS0225T. cruzi epimastigote normalized cDNA Library
16190493017897AA891018TENS0868T. cruzi epimastigote normalized cDNA Library
17442893215230AI005720TENU0352T.cruzi epimastigote normalized cDNA Library
17973853331800AI057934TENU2026T. cruzi epimastigote normalized cDNA Library


Date: 15:15:16 on Wed 22 Nov 117.