CcruzaQ_1607


Sequence

>CcruzaQ_1607 (2 EST) Length=559 TGATACGCAAGCACGTGTGGATGTTCGGAGCGGCCGGCGCACCGCACGCTGAGAGCATGGCACGGTGAGAACCGGACCTA GAAAAGGGACACCGCGTGGGACGTCAGTCTTCACTGCAGCGACCGCCACCGAATTCGGGTTTGCTCGCACGTCCTGCGGT CCCTCTTCCCTCACTTCTGTGCCGAGTACTGTGCCGCGGGATCCAGCAGCGCGATGTTTGGCCGCAGGAACATGGCCCGA ACAAATGATTTGTGGGAGGGGGATGTGCACTGCGACGAGAAGGAAGAAAAGGTTGCGAGACGACCACCACGACAAGACCG GAGTGAAGTTGTGTTTTGTCCACTTGCGCGAGGACGGCCTGCCACCTGGTCGGTTGGGAGGATTATTTTTTTTTGCGTCG TTGCGCTCTCTTTTATTCCGCCGCGTTTTCTTGCGGACCTGCGAAGGGAGACTTGCAAGAAGTTCCTGCGAGGCGTCCGT GCCGTCGTCGGGAAGGCGAATCCCCCCTGAAAAACGCTACTTTATAAATTTGTTTTGGGCGGGGAGTTCCCGTCGATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1607: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610733237480AI021867TENU0554T. cruzi epimastigote normalized cDNA Library
17972843331699AI057833TENU1924T. cruzi epimastigote normalized cDNA Library


Date: 21:47:18 on Fri 17 Nov 117.