CcruzaQ_1610


Sequence

>CcruzaQ_1610 (4 EST) Length=374 GGTATTAATATGAAATATATCAAAAACAATCTTCCTCTCTCTCCCCTTCTCTCCCCCTCAATTGAAAAAGAAAAGGGCAA AACTTCAATGGCTCCCCTCCTGAATGTGTTGGCAAAAATCCGTCGGGCCTGCTCCCCTTCCAAAAAGGCGGTCTTTGTTA AACTCGGCCGGTGGCCCCCTTTTCCCCGAAAACTCCTGCTCAAAATGGGCAACCTCCTCGCGCTCCGTTCTCCCCCAAAT AAAACGCTGAAAAAAAATTCCCGGACTTCTCTTGTTTTCTGGGAATAACAAATGGTCCCCAAACCTTCCAAAAATTCCTT ATTATGTTCTTACCTATAAAATATGTCATTTTAATATATCCATAAAATATATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1610: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775932130776AA433299TEUF0118T.cruzi epimastigote non-normalized cDNA Library
13817452655823AA676159TEUF0027T.cruzi epimastigote non-normalized cDNA Library
13817652655843AA676179TEUF0103T.cruzi epimastigote non-normalized cDNA Library
17855083294014AI046116TENU1202T. cruzi epimastigote normalized cDNA Library


Date: 4:44:56 on Sat 25 Nov 117.