CcruzaQ_1618


Sequence

>CcruzaQ_1618 (2 EST) Length=420 CCCGAGAGATATGGCCACTCTTGCCGCATATGTGGCACAAATCACTTGGATGCGGTCTTGGCGATCTGGAACGCTCCCTG CCGCGATCCTTCGAGCGTTCTCGCTTGCGGTCACTTCCTCGGCTATGTTTCTCCTTCTTCTTCCAGTACTTCGCCTGCTC CTTCTCCAACTTCTCCATGAGCTTGCGGGAGACTTTGACGATGTGCAGATAGTTGCACTGTGCCCCGCGTCCACACTTCC CCTCAAGATCTTCCTTGCAGCAGGCGTCGGCAAAGTTGGTGACAGGACTCAGCTCCGGAAGAAGAATAATTTCGTTTAAC TTTTTCGCCTTTAGTTCCCGCGCAATGTGAGACGCGTCCGCGGCTTCTTCAAAGCGAATGTACACATTCCCGAGGAGGTG TCACCCAGATTGCTCACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_1618: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17971793331594AI057728TENU1818T. cruzi epimastigote normalized cDNA Library
18386843417096AI080844TENU3701T. cruzi epimastigote normalized cDNA Library


Date: 13:45:11 on Thu 23 Nov 117.