CcruzaQ_1637


Sequence

>CcruzaQ_1637 (2 EST) Length=512 ATATNTCAAAAACAGTAAATCCATCACTTCAACAATGAGCATTGAGAGCGCCTTTTACGCCTTTGCCTCCTTTGGTGGTG CGCCCACGAAAGAGATGGACAATGCTCACTTCTCCAAGATGCTGAAGGAGACGAAGGTCATTGGAAAGCAATTCACCAGC ACCGACGCCGATCTTCTCTTCAACAAAGTGAAAGCAAAGGGAGCCCGCAAAATTACATTGTCGGATTTTGTTGACAAGGC TGTTCCTGAGATTGCATCAAAGTTAAAGAAGTCCGCGGAGGAATTGATCGCCAGATATTTCAAGTTGCTCTCCCGAGGCN ACGCGCAACCAANGGCCGATGCAAGTGAAGTTCCACCGACGATAAGAATATGTACACTGGTGTCTACAAGCCGGCGGGCC AACAAACGTGGATCGCAACTCCGGCTCCCTTTCAGGTGTCGTGGATCCCGTGTGGCGCAGACTGACGTTCGTGGCACGAC TGCTTCCCAGAAGTAAAGAGGGAAACGAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1637: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12063972327476AA556024TENF0023T.cruzi epimastigote normalized cDNA Library
17855613294067AI046169TENU1256T. cruzi epimastigote normalized cDNA Library


Date: 18:47:28 on Thu 23 Nov 117.