CcruzaQ_1640


Sequence

>CcruzaQ_1640 (3 EST) Length=766 CTAATGGCAAGCGACAATGTGAACGATTGGATTCGCATCAGTGAGATGCTGCTCGGTCCGGCTGGTGAAAAGTTCCGGTT CACACCAAAGCACAGGAGTAACAGCTACACCACCACAGCAACGACAGGCGAGGCAGAGATCTAGTGGGAGAGATGACACT CACGAGAAACGGGAAGAATAAAAACACGCGTCCGCAAACAGCATGAGGTGCAGCCGCCCCCATTTGAAACACAGCTCTAC TAACGTTGACCCTGGCAATGCCGGCCACCGCAGCGTGGCGCCAGGGTCGATTGCCCCGTATTGTCGGGGGAAGCCAGGAG CCAGCAATATTTCCCTCACGGGATTTGTTGCTGGTTGGCACGGGGCTGACGGTATTCAACCAGTGCCACAAAAGCCGCGT CTTTCTGGGGCACAGTTGTAACGCCATGAGGTGTAGGGGCGCGTGCTGCCGTACGGCGTGCGAGCCATCGGATTTATTTG TGAAACGATGAGAAAAGAAAATTAAAAAAACAGGACAAAAGTTAACGCTGAGTGCCACAAGGCAATTGGACGAGGGTAAG AAAGCAAGAATGAAATTGAAAGGAATAGAAAAGAGCATCGGAGACAAGGAGGGCATGTTTTTCTTGTTGTTTTTGTTCCC TGGTTCGTTTCCAACCCCCGCCAAATCAGGGCATCCAATGCAACTTTTAGGGTAATNCCAGGTGAGGGTNTTACGTGGTT TCACTGTTCTTCCTGTGCATGTTTATGGTGATATATTAGTGATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CcruzaQ_1640: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10709802107924AA426687TEUF0033T.cruzi epimastigote non-normalized cDNA Library
12064602327539AA556087TENF0344T.cruzi epimastigote normalized cDNA Library
15577022909890AA835604TENU0063T.cruzi epimastigote normalized cDNA Library


Date: 6:13:6 on Thu 23 Nov 117.