CcruzaQ_1644


Sequence

>CcruzaQ_1644 (2 EST) Length=505 TTTAACAAGAGAAATTTTAATTAAAATGCGCCGTCTTACTGTCTCTAGGCTTTTCTCCGCTGCCGTCACGACTCGTGCGT TGACGACGTTGACAGTCCGTGAAGCGCTTAACAAGGCCCTCGACGAGGAGATGGAACGTGACAATAAAGTGTTTATCCTT GGGGAGGAAGTAGGCCAGTACCAAGGTGCGTATAAGGTGACCAAGGGACTTCTGGACAAGTGACGGCACTTCGAGCGTTA CCTCGACATGCTCCATCACGGAACACGGTGTTGTGCGCCGACTGCCCCACGCCGTACGCGAAGGATTTGGAATTGGCATC GCAGCCGCAGGTGTCAGATGTTCTTGCCGTAGCCCACCGTGTCCTCAGCTGAACTGAGGAGCTGGGATTTCAAGCAAGTA GGAGAANTNAGAAGGAAAAAGACCCAGAACAGAAANGGGNGNGTGAGTTTCGAGTAGATGGAAATGCNTGGAGNNGACTT TNNGCCTNGTGCNACCTCNGAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1644: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16582453073764AA926628TENS1250T. cruzi epimastigote normalized cDNA Library
18048423340794AI065387TENU2274T. cruzi epimastigote normalized cDNA Library


Date: 19:12:57 on Wed 22 Nov 117.