CcruzaQ_1656


Sequence

>CcruzaQ_1656 (2 EST) Length=367 CACTTTAAAGCATCGATGAAGCGGCGTACTTCCTCTAGAGACTCAGTGCTCAGCTCTGACAAAAGCACCTTTACTGCCTG CACGACACCTGTTTCAGTTGGGCCAATTTGAGGTGGTTGCAGGTGGATCGCACCCATCCCGCCGTTGCCAGAAGACGCCC TCTTGGTGTGAATGGAATGATTCATCGGGTCGAACTGGGAGTGGTGAGAGAATTCTAAATGCGTGCTCCGCCGCCTTGTC GCATGCGTCCTTGTAAGACTGCGGGAAATAGAAACACGTCTGTCGCCGTTGCCATGTGCAGCATGGTCATCCGCATAAGC AGAGATGCGGGCATGGTGAGACCCGTTTGCACTGTGTGTTTTGCTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1656: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16097932991942AA882831TENS0406T. cruzi epimastigote normalized cDNA Library
17459413216882AI007372TENU0392T.cruzi epimastigote normalized cDNA Library


Date: 6:40:31 on Sat 25 Nov 117.