CcruzaQ_1660


Sequence

>CcruzaQ_1660 (2 EST) Length=435 TTACCCTATAATATATANAGATAAGAAAGTACACAAATTTCGTTTTCTCCTTATTCTCCTTATCTCTCTTCCCCACATCC ATAATTATTTTTATTTTTATTTTTTTGCTCAATAGAGAATCCAAGACGGATCCTCATTTTTTTTTGAAAAGCATCATTAA TTAGCGAGAAAAAAGGCGTGGGTATGGAGGAAGAAAATACTGAAGGCGCCTTTCACCCGCCGCCCACGTGGAACGGTGAG GGCTGGGTCACATGTGCTTTCACAGGCTCTTGGAAAATACACACACACACACACACACACGGGGAGAAATGTATCATAGG GTTCAACGATATAAGATCTCTTCCGTTGCTTATGAACCTCGTGCCGTTTTTTTTTAAAAAATTTTTTTTTCTTTTTTTTT CGGCTTCAGTTCGTGTTTCCTCAACACTCCGGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1660: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767822275718AA532186TENF0305T.cruzi epimastigote normalized cDNA Library
18688313482838AI110302TENU3974T. cruzi epimastigote normalized cDNA Library


Date: 13:42:15 on Thu 23 Nov 117.