CcruzaQ_1697


Sequence

>CcruzaQ_1697 (2 EST) Length=399 CTTCTTCTTTCTTTGACTTTTGTTACTTATTTTCNATGTTGTTGTTGTTGTTGTTGTTGTTTTTATGTGAACTTTTACGT ATCTCTCGAATGCGTTTATTATTATTGTTTTTTGTCCCCCTCTGTGCACAAGGTCTATCTATCTATCCATCTGTGTTTGC GTGCATGCATGCATGTATGAAATGCCACCATGTGCACAAACACACACGCACAGACACTTTCCCCCTCTCTTTCTGCCCTG GTGATTTGTATGCAGACATTTTTGTGGGCGAATGCCTTCGAGAGCGCCGGCGGGAGGAGATGGAGAGGGAGTGAGGTGGA AAACAAACAAACAGAAAGAGAAGAAAAAAAAAAGAGAAGGAAATGACTGAAATAAAAAAAGAATGAANTCGACGATCNN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1697: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944883124064AA958107TENS1640T. cruzi epimastigote normalized cDNA Library
17855533294059AI046161TENU1247T. cruzi epimastigote normalized cDNA Library


Date: 4:31:16 on Wed 22 Nov 117.