CcruzaQ_1714


Sequence

>CcruzaQ_1714 (2 EST) Length=522 TAGAAATAACGCAGAAGAGGCATGCCAACAAACAGAAAATATGCGTTTGTATGAGGCTTTGCTTNCCTATTCCTACAGAG TGAAGGCGGGANATAAAGGAGCACGACACTTTTGTTCAGTGTACCCAGTATCCTCCANACCTCATAAAATGATGTATTCA ACACACACACACACACACACAAAAGAAAAAGTAAAGAAACAAATGCGCTCATAACTCAAAATCTAAGAAAAAACGAACAC ATTGTGAACTCACGAATTGTTACTCTGTAGGATCACGCAACCACCGGGGCCCCGCTTCCCGCGAAAGGGCGGTATTTTAG AAGGGGGGAGGAGAAGGAGGGGAAACGGTGCCCCGGTGGGAAGACAGAAAAGAAAATTAACCCCGCTGCCTTAAACCGCG GTAACTTTTTAACATCCACAACAAATAACAATAACAGTTAATGGATAGAGAAAACACATAACTTGAACAATACGCCAGGC CATCCCTCGTGCTTGATTAATTGNGCCTCAGAGGCCAATATN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1714: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15926952961965AA866520TENU0092T.cruzi epimastigote normalized cDNA Library
16098822992031AA882920TENS0497T. cruzi epimastigote normalized cDNA Library


Date: 2:47:33 on Thu 23 Nov 117.