CcruzaQ_175


Sequence

>CcruzaQ_175 (2 EST) Length=551 GGACTATGTNCNAAATAGGCGGGCGGGAGACNTTGCATGGAGGCTTTTGCCATCACTCCCTTGGCGGAGGACNACACCAC ATTTGTTAAANATGCCCAGCAGTTCCTTGCCGTCATCGCTGACATGCAGCGCGAGGCGGAGCAACGGCGTTGCCTTCTGG ATGACTTGCGACAGAAGGAAGCAGCCGCCGANATGGAGCTGGAGAANTGCCTTGCTGTGCGTGAGGCGGTGGTGGCCCGT ATGGCGCACACGAAGGCCGAAGGGTTGGAACTGCAGTCGGAGTACAAGGCGCTCACCACACAACAGCGGGCGGTGGAAGC GGAGGTGTTGGAGCTGCGCCGTCAGAAGAACCACTGGAAGAAAGTGCTGCAGGAGTTTCAGGGATCATCATCATCATCAC ATTTGCTGGGGAATGGCAACACGGATGGTGCGACGGTGAANAACGCATCATCTCTTGACCGTGCCCTTCATGCGTTGAAC CAACTACCACNCNGCTCTATNTTTTTTGAAGGANCTGAAAAAAACTCTGACNAATTTTNTTGCAAAACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CcruzaQ_175: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16581613073680AA926544TENS1166T. cruzi epimastigote normalized cDNA Library
17973133331728AI057862TENU1953T. cruzi epimastigote normalized cDNA Library


Date: 11:25:37 on Sun 19 Nov 117.