CcruzaQ_1759


Sequence

>CcruzaQ_1759 (2 EST) Length=590 GCTACAGGCAGTACGAGGGACCCCGCACGGGGACGCCCCCAGTTCAACAGAACGGGAAGCACGGATTATGCTCGCCTTGT GAGGGTGCCGAAGTACGTCACGTTGACTGACATAAAGGCGGCGGTAACGTCTGTCCTTGGCGCGGAGCCGATTGATGCAT ACTGGTACGGCCGCAGTAGTGCCGACTGTGTGCTGCAGCTACGGTCGTCCAATGCTGTGGAGCAGCTGGTGCGAGATTCC GTGACGGTGCTGGAGTCGAGGCTGAGTGCTGCAAAGTTCTACCCGTAGAAACGAAAGGAAAATATTTACTTCCCCGCCAA TAAACAAAAAAAAAAAAAAAAAAAAAAAGATGAGGATCCATTCAAGTCCAACGCGACCTTCCGGGTNTAATTNTGCTTGG CGTTGTGTGCAGCAAGACGCTCACGGCGGGCCTTCACGGCAGCCTTCTGGTTGTTCTTGCGCACACGACGGGCGTTGATG AGAGCCGGCAGCCAGCTGCCACGCTTCGAGTTGTGAAGATACATCGGCAGCGCGCGCTTGATGCCATTGCGATGGTTTTT CCGCGACTGGTTGTGGTTCGTGTGTTCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_1759: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11767042275640AA532064TENF0350T.cruzi epimastigote normalized cDNA Library
15941492963405AA867960TENS0068T. cruzi epimastigote normalized cDNA Library


Date: 0:21:44 on Sat 25 Nov 117.