CcruzaQ_1778


Sequence

>CcruzaQ_1778 (3 EST) Length=379 GTTTCTGTACTATATTGGAGAGTTTACACCGCGAGCAACAAGCGAATTCGGCACAAAGGCCCAACTGACAATGATGCTGC GCCGCGTCCTCTGCGTGCTTCTCTTTGCCCTCTGCTGTGCGTGCGTGTGCGCCACGGCTCAGGAGGAGGGGCAGTATGAT GCTGCTGATGTTGAGGCTGGGGACGGCCCGGATGAAACTACAACCACCACTACAACTACTACTACTACGACGACAACGAC TACCACCAATGCACCCGCCAAGAACACAACCACCTCCAAGGCACCGACTCCTGGCGACGGGAGCAGCCTCGGCGGCCCTT TGTGTGGTTCAGGTGCCGCTGGCTGCTGCTGGTCAGTGCCGCTGTGGCGAACGCCGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CcruzaQ_1778: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776522130835AA433358TEUF0217T.cruzi epimastigote non-normalized cDNA Library
11767402275676AA532100TENF0424T.cruzi epimastigote normalized cDNA Library
16945853124161AA958204TENS1740T. cruzi epimastigote normalized cDNA Library


Date: 21:37:5 on Fri 17 Nov 117.