CcruzaQ_1795


Sequence

>CcruzaQ_1795 (4 EST) Length=1028 CTTCAGCCTTCGTGGAAATTCTCTCGTTATCTCCACATGTCGCCTTTTTCGTTTCACTTTTTTTCTCTCTTCATTTCCCC TCTCCTTGGAAGGGGAGTGAGTGCGCTCCGCCTCAGAAGATGTTGTTGGTGCCGGTTTTGGGCGCATACACACCACGAGC AGCGCCCACCGCGGGGTTCGATATCGGGGGACTTGGAGTTGAAGAGTTGGCCCGCTTCCAGCTTCTTCCCCGACCCGCCC GCGGCTGCGTTAGCTGAAGCGGGACGTGCGGGAGCTTCCACCAAATCCTTGCGTTTCTTCGACAAATTGGGCGCCTCTTC ATAGGTGAGCAATTGGCTCGGGCGGAAAGGCCTTGGGGGTTTNTGCTCCAGCGGAGGGCCGCCGAAAATGTTTGCAGCAC AACTGTTCTTCGGGGCGCTGGCACCAGGATTTCTTGCGGTGCACCGGCTCGACGTCCTCAACACCTTTGCCAGTACCAAA AATGTCATGCGTCTCATTCGCGTGCGACTTCAAACGGGCAATGATGGGGCGCTGGCGAGGAGGCAACGACGCCGGGATGA ACTGGCGAGGCCCAAGCACAAGATTGAACAACAACCTCGTTTAGGTCTTCGCGGGTATACTGACCAAGGTTCAGCACGTC AAGCGACTCATTCGCCTTGTTTCGGCGTGAGTGCAGCAATCGTTCTGCCTTTCTGTCGGCCTCGGCTTGACGAGTTGATA TGGTTGCACGTCCAAAGAGATTCACGCTGGTTTGTTCATGGAAGCGCCGCTTTCCCTTTACGGGCCAACTTTCCGCGGGC CGAGGCGGGAGCTCCGTTTCGCTGTAAGGAGCTGCAGTGGTGTGCGGCGGTGCCAGTCCTGGTGCCCGCTGTAGCCGGCG CTTCGCCTCTTCCGTCCTGACGCTGCAACAAAGACCCTCGAGATTGTCCTTAGGACCGCGTTGCCTCACAACGTGCTGCG GCACGGGATCGTCCTCCTTGCGGCCGAGGATCCACTCCTCTGTGAGAGACTTGCCGACAGTGGACTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1795: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10860612153645AA441767TEUF0060T.cruzi epimastigote non-normalized cDNA Library
16580673073586AA926450TENS1072T. cruzi epimastigote normalized cDNA Library
17658193244437AI026611TENU0824T. cruzi epimastigote normalized cDNA Library
18244803392718AI069743TENU2788T. cruzi epimastigote normalized cDNA Library


Date: 11:35:36 on Wed 22 Nov 117.