CcruzaQ_1797


Sequence

>CcruzaQ_1797 (3 EST) Length=357 CCAGTTATCCTGGAGGGGAAACTTCGATTTGAACCCAGCCTACTAGGTGGTTCGATGAGTCTTTGCTCCGATACCCAAAT CATGCGAAGCGATTTGCNACGTCAGCATCGCTACAGGCCTCCACCCGAATTTCCCCGGGCTTCACCTTGTTCAGGCATAG TTCACCANCTTTCGGGTCCAAACAGGCACACTCCAACTCAACCCACGGGGGGCCGGTCGGTGTTGGGCAACAACAAATAA TATATGGTTATATATTATTCATTAAGTGTGCACACCACAGATGCAATTTGCATCTCCCTTTCAGTACGAGAGAAGTACTG GCAACGATATCTTCTCCCTTGCGCGTCTGTTTGACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CcruzaQ_1797: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
13817862655864AA676200TEUF0262T.cruzi epimastigote non-normalized cDNA Library
13817882655866AA676202TEUF0268T.cruzi epimastigote non-normalized cDNA Library
13817892655867AA676203TEUF0278T.cruzi epimastigote non-normalized cDNA Library


Date: 3:56:37 on Sat 18 Nov 117.