CcruzaQ_1807


Sequence

>CcruzaQ_1807 (2 EST) Length=433 TCCATGTGCATGAGGAACAAATAGCGATGCATCGTGCGAGGTGCAACGACAGCCAGGGGTCTCTTTGCACCCAGATGCTC CGGAACATGCTCGGCGTACTGTACCTCCCGTTCCCACATCGTTGGCGAACTGAGCGGAGTGTGCCATGACTTGAATAACC ACGTCGGCGTTGGATCCCTTCGATACGTACTGCACCTGCGGTAGCGGTTTCTTTACCAGCCGGCCGCGTTTGACAGACAA ATACTCAAACTCCCGTCCACCACGGCCGTAGTCTGTAGGACACTTCGCATGTGAATAGTGCTGATGGTACATGTGCCGTG TCTCGCCTTCTCCCCAGCGCGAGACGGTGCTTTGGTTGTACATGTACTTGTTGTGGTTACCCCGCCACATGGCGTAGTAC GGCAGAGGATACACGAGGCCTTTTAGATGCCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CcruzaQ_1807: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17927303321066AI053187TENU1608T. cruzi epimastigote normalized cDNA Library
18689893492626AI110419TENU4022T. cruzi epimastigote normalized cDNA Library


Date: 22:13:48 on Fri 17 Nov 117.