CcruzaQ_183


Sequence

>CcruzaQ_183 (2 EST) Length=550 CCTCNGAGGCCNCCAATTCGGCACGAGGTTCAGCTGGAGTTTGCCATCGAAAACGTTTGACCCGAACGCGAAGAAGCACT CGGACGCCAAGAAGGAGCTGTACAAGCTCCGCGCGCAGGTGGAGGAGGAGCTGGAGATGCTGAAGGACAAGATGGCGCAG GCGCTGGAGATGTTTGGCCCGACCGAGGACGCGCTGAACCAGGCCGGCATTGAGTTTGTGCATCCCGCCGAGGAGGTGGA GGACGGCAACCTGACCCGCCGCAGCAAGATGGTCGAGTACCGTGCCCACCTGGCGAAGCAGGAGGAGGTGAAGATTGCGG CGGAGCGCGAGGAACTGAAGCGCTCCNAGACACTGCNGAGCCAGCAGTNCCGCGGCAAGACGGTGCAGCAGATCACACAG TAACCTGTGTCCGCCGGTGCCACCCAACGCTGTTGCTGTTTTCCCCCTTCCATGTATTTTTTTATGTTATATCTCCNTTG TTGGAAAAAATAAGAAACCANTTCCCTGCCGCTGCCAATGATAATGGTGGGTTGCCNCCCCTTTTTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CcruzaQ_183: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16360863046127AA908055TENS0895T. cruzi epimastigote normalized cDNA Library
16944993124075AA958118TENS1651T. cruzi epimastigote normalized cDNA Library


Date: 15:23:50 on Thu 23 Nov 117.